Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Materials and methods br The MCF cell line

    2020-08-18


    2. Materials and methods
    The MCF-7 cell line (gift from Dr. Spencer Gibson) was maintained in a humidified incubator at 37 °C with 5% CO2, grown in Dulbecco's
    Modified Eagle's Medium (DMEM) (Invitrogen, Burlingon, ON, Canada) supplemented with 10% fetal calf serum (FCS) (Invitrogen). DNA sub-strates were purchased desalted and lyophilized from Integrated DNA technologies (IDT). The following sequences of DNA were used: SS-DNA (5′AGCGTTAGCGTTAGCGTTAGCG3′), DS-DNA was formed by the ad-dition of (5′CGCTAACGCTAACGCTAACGCT3′) to the SS-DNA, G4-DNA (5′AGGGTTAGGGTTAGGGTTAGGG3′). Phthalocyanine samples Pc1 and Pc2 were received from Professor E. A. Lukyanets. 1,3-Diphenylisobenzofurane was purchased from Sigma and used as re-ceived.
    2.2. UV–vis and MCD spectroscopy
    UV–vis spectra were collected on a Jasco V-770 spectrophotometer and magnetic circular dichroism (MCD) spectra were measured with a Jasco J-1500 CD spectrometer using a Jasco MCD-581 electromagnet which was operated at 1.0 T. The H 89 2HCl spectra for the DNA ti-trations were collected with a Varian Cary 50 spectrophotometer and the fluorescence data were measured on a Varian Eclipse spectro-fluorometer.
    2.3. DNA binding titrations and singlet oxygen yields
    All absorbance titrations were run in an aqueous 50 mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer (pH = 7.0) and 100 mM KCl mixed solution. Pc1 and Pc2 were diluted until a nominal absor-bance of 2 A.U. at the Soret/Q-band was achieved in the optical spec-trum. A 100 μM solution of DNA was prepared by heating the dissolved
    Corresponding authors.
    E-mail addresses: [email protected] (S.A. McKenna), [email protected] (V.N. Nemykin).
    DNA to 95 °C for 5 min before a slow cooling to room temperature (5 °C/min). Absorption and fluorescence spectra were collected after each 1 μL addition of DNA solution until saturation was achieved. Singlet oxygen yields were determined using 1,3-diphenylisofurane as a singlet oxygen scavenger following standard procedure [37]. The custom-made apparatus used was a 100 W white-light bulb in a 60 W lamp which was equipped with a 630–760 nm band pass filter. The intensity was calculated to be 1326 W/m2. A 1 cm cuvette was used for all experiments. In all experiments, concentration of Pc1 and Pc2 in a buffer solution was held between 10−5 and 10−6 M.
    2.4. Cell culture and reagents
    MCF-7 cells were seeded at 50,000 cells per well in 24-well cell culture plates (Thermo-Fisher Scientific). Pc1 and Pc2 compounds were dissolved in water and sterilized using a 0.22 μM cellulose syringe filter prior to cell treatments. After 24 h, Pc1 or Pc2 or water was added to the cell culture media to a final concentration of 5 μM and incubated at 37 °C 5% CO2 for a further 24 h. The cells were then rinsed with PBS and the media replaced with fresh DMEM + FCS. For the experiments with fixed cells, the samples were irradiated (or not) for 5 min with a FluorChem Q imager (Protein Simple) using the CY5 excitation filter (620–720 nm band pass). Cells were returned to the incubator for 4 h before imaging. Immunofluoresence experiments were performed as described previously [38] using AlexaFluor 488 conjugated anti-H2A.X (P139S) antibody (Thermo-Fisher Scientific, CR55T33), Prolong Dia-mond mounting media containing DAPI (4′,6-diamidino-2-pheny-lindole, Thermo-Fisher Scientific) and imaged at 40× using an EVOS FL Auto imaging system (Thermo-Fisher Scientific). For live cell imaging, samples were irradiated for only 1 min before the cell culture media was changed to Live Cell Imaging Solution (Thermo-Fisher Scientific) and the cells were imaged on the EVOS FL H 89 2HCl Auto imaging system. In-dividual wells were used for each time point to minimize the effect of additional reactive oxygen species (ROS) produced by imaging the phthalocyanine compounds (using the CY5 filter with band pass be-tween 620 and 700 nm) that would affect the progression of cell death in further time points. The LD50 for Pc1 and Pc2 were not calculated; the non-irradiated cells did not suffer from the treatment and the signal from the H2AX antibody is very close to background with no distinct foci observed.
    2.5. DFT calculations
    Density Functional Theory (DFT) and Time-Dependent DFT (TDDFT) calculations were conducted using Gaussian 09 software [39]. Hybrid TPSSh exchange-correlation functional [40] was used in all cases. A standard 6-311G(d) basis set was used for all atoms [41]. The 
    first 80 excited states were considered in TDDFT calculations. Mole-cular orbital compositions were determined using QMForge software [42] and the frontier orbitals were visualized using GaussView pro-gram.