Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br AUTHOR CONTRIBUTIONS br DECLARATION OF INTERESTS br

    2020-08-07


    AUTHOR CONTRIBUTIONS
    DECLARATION OF INTERESTS
    The authors declare no competing interests.
    REFERENCES
    Finkel, T. (2011). P 22077 by reactive oxygen species. J. Cell Biol.
    Alpha-Tocopherol, Beta Carotene Cancer Prevention Study Group. (1994). The effect of vitamin E and beta carotene on the incidence of lung cancer and other cancers in male smokers. The Alpha-Tocopherol, Beta Carotene Cancer Prevention Study Group. N. Engl. J. Med. 330, 1029–1035. 
    van Zandwijk, N., Dalesio, O., Pastorino, U., de Vries, N., and van Tinteren, H. (2000). EUROSCAN, a randomized trial of vitamin A and N-acetylcysteine in patients with head and neck cancer or lung cancer. For the EUropean Organi-zation for Research and Treatment of Cancer Head and Neck and Lung Cancer Cooperative Groups. J. Natl. Cancer Inst. 92, 977–986.
    STAR+METHODS
    KEY RESOURCES TABLE
    REAGENT or RESOURCE SOURCE IDENTIFIER
    Antibodies
    Santa Cruz Biotechnology
    BACH1(F-9), Mouse monoclonal antibody (Chip-qPCR)
    Santa Cruz Biotechnology
    BACH1, Goat polyclonal (Chip-Seq)
    R and D Systems
    R and D Systems
    GAPDH, Mouse monoclonal antibody
    Sigma-Aldrich
    Life Technologies
    Sigma-Aldrich
    Abcam
    LAMIN B1, Mouse monoclonal antibody
    Santa-Cruz Biotechnology
    Sigma-Aldrich
    Cell Signaling Technology
    Santa Cruz Biotechnology
    Santa Cruz Biotechnology
    Cell Signaling Technology
    Life Technologies
    Jackson ImmunoResearch Labs
    Jackson ImmunoResearch Labs
    Lab Vision
    Abcam
    Millipore
    Abcam
    BioCheck
    Bacterial and Virus Strains
    Ad5CMVCre Cre-adenovirus Viral Vector Core Facility,
    University of Iowa
    Chemicals, Peptides, and Recombinant Proteins
    Sigma-Aldrich
    Sigma-Aldrich
    Sigma-Aldrich
    MedChemExpress
    Bortezomib (1 mM)
    MedChemExpress
    Sigma-Aldrich
    Cycloheximide (20 mg/mL)
    Sigma-Aldrich
    Diamide
    Sigma-Aldrich
    Dichloroacetate Sodium (DCA, 10 mM)
    Sigma-Aldrich
    Sigma-Aldrich
    Sigma-Aldrich
    Sigma-Aldrich
    Hexadimethrine bromide (polybrene) 8 mg/mL
    Sigma-Aldrich
    Hydrogen Peroxide
    Sigma-Aldrich
    MedChemExpress
    Sigma-Aldrich
    BioVision
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    MedChemExpress
    Sigma-Aldrich
    Sigma-Aldrich
    Xfect Transfection reagent
    Clonetech
    X-tremeGENE HP DNA Transfection Reagent
    Sigma-Aldrich
    Critical Commercial Assays
    ROS-glo
    Promega
    Glucose-uptake-Glo
    Promega
    Lactate-Glo
    Promega r> Pyruvate Assay Kit
    Abcam
    Seahorse Glycolytic Rate Kit
    Agilent
    Seahorse ATP production rate
    Agilent
    CellTiter-Glo
    Promega
    GSH-Glo
    Promega
    GSH/GSSG-Glo
    Promega
    NAD(H)-Glo
    Promega
    NADP(H)-Glo
    Promega
    Dual-Glo Luciferase Assay System
    Promega
    Epitect Chip One day
    QIAGEN
    Heme Assay kit
    Sigma-Aldrich
    Deposited Data
    RNA sequencing and Chip-sequencingIndividual This study GEO: GSE128181; https://www.ncbi.nlm.nih.
    links below)
    RNasequencing data mTC/mTN
    This study
    ChipSequencing data on BACH1 mTC/mTN This study
    Experimental Models: Cell Lines
    Clonetech
    Life Technologies
    ATCC
    ATCC
    ATCC
    ATCC
    ATCC
    ATCC
    ATCC
    Bergo Lab, this study
    Experimental Models: Organisms/Strains
    Jackson laboratories
    Bergo lab
    Oligonucleotides
    sgdTomato 50–GGCCACGAGTTCGAGATCGA–30
    Bergo Lab, this study
    mouse sgBach1_m1 50-GTACTTCCACTCGAGAATCGT–30
    Bergo Lab, this study
    sgBach1_m2 50–GTCTGGCCTACGATTCTCGAG–3
    Bergo Lab, this study
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    sgBACH1_h1 50–CCTGGCCTACGATTCTTGAG-30
    Bergo Lab, this study
    sgBACH1_h2 50–CCACTCAAGAATCGTAGGCC–3
    Bergo Lab, this study
    sgBACH1_h3 50–TACTCAGCCTTAAT-GACCAG–30
    Bergo Lab, this study
    SAM sgBach1_m2 50–GGCCCGGGGGCGGAACCGG–30
    Bergo Lab, this study
    SAM sgBACH1_h2 50–GACACATCAGCACCGCCCTCG–3
    Bergo Lab, this study
    EpiTect primers for Hk2
    QIAGEN
    EpiTect primers for Gapdh
    QIAGEN
    Taqman assay for Bach1
    Life Technologies